Indian Journal of Human Genetics
Home Current Issue Archives Guidelines Subscriptions e-Alerts Login 
Users online: 56
Print this page  Email this page Small font sizeDefault font sizeIncrease font size


 
ORIGINAL ARTICLE
Year : 2008  |  Volume : 14  |  Issue : 3  |  Page : 82-86
 

Standardization of PCR-RFLP analysis of nsSNP rs1468384 of NPC1L1 gene


Department of Biotechnology, Punjabi University, Patiala-147 002, India

Correspondence Address:
Divya Khanna
Department Of Biotechnology, Punjabi University,Patiala
India
Login to access the Email id


DOI: 10.4103/0971-6866.44999

PMID: 20300301

Get Permissions

 

   Abstract 

Niemann-Pick C1-like 1 (NPC1L1) protein, a newly identified sterol influx transporter, located at the apical membrane of the enterocyte, which may actively facilitate the uptake of cholesterol by promoting the passage of sterols across the brush border membrane of the enterocyte. It effects intestinal cholesterol absorption and intracellular transport and as such is an integral part of complex process of cholesterol homeostasis. The study of population data for the distribution of these single nucleotide polymorphisms (SNP) of NPC1L1 has lead to the identification of six non-synonymous single nucleotide polymorphisms (nsSNP). The in vitro analysis using the software MuPro and StructureSNP shows that nsSNP M510I (rs1468384), which involves A®G base pair change leads to decrease in the stability of the protein. A reproducible and a cost-effective PCR-RFLP based assay was developed to screen for the SNP among population data. This SNP has been studied in Caucasian, Asian, and African American populations. Till date, no data is available on Indian population. The distribution of M510I NPC1L1 genotype was estimated in the North Western Indian Population as a test case. The allele distribution in Indian Population differs significantly from that of other populations. The methodology thus proved to be robust enough to bring out these differences.


Keywords: Influx transporter, M510I, NPC1L1, single nucleotide polymorphisms


How to cite this article:
Balgir PP, Khanna D, Kaur G. Standardization of PCR-RFLP analysis of nsSNP rs1468384 of NPC1L1 gene. Indian J Hum Genet 2008;14:82-6

How to cite this URL:
Balgir PP, Khanna D, Kaur G. Standardization of PCR-RFLP analysis of nsSNP rs1468384 of NPC1L1 gene. Indian J Hum Genet [serial online] 2008 [cited 2013 Jun 19];14:82-6. Available from: http://www.ijhg.com/text.asp?2008/14/3/82/44999



   Introduction Top


Niemann-Pick C1-like 1 (NPC1L1) protein, a newly identified sterol influx transporter, located at the apical membrane of the enterocyte, which may actively facilitate the uptake of cholesterol by promoting the passage of sterols across the brush border membrane of the enterocyte. [1],[2] The protein has been characterized by the presence of a signal peptide, 13 putative transmembrane regions, a conserved NPC1 domain and a sterol sensing domain (SSD). Although expressed within several tissues in the body, the expression is predominant in liver and small intestine. [3],[4],[5] In rodents, NPC1L1 is highly expressed on the surface of jejunal absorptive cells whereas in humans the expression is more in the hepatoma cells in the liver. [6] The protein plays a key role in cholesterol uptake and intracellular cholesterol trafficking from the plasma membrane to the endoplasmic reticulum. [7] A fact further strengthened by the observation of Gracio-Calvo et al. [8] that the protein was the direct molecular target of ezetimibe, a drug that inhibits cholesterol absorption. Recently, Temel et al. [9] have suggested the presence of NPC1L1 on the canalicular membrane of hepatocytes which may modulate biliary cholesterol excretion. Thus, this protein is actively involved in the cholesterol homeostasis pathway. [10],[11]

Single nucleotide polymorphisms (SNPs), together with copy number variation, are the primary source of variability in the human genome. As amino acid substitutions currently account for approximately half of the known gene lesions responsible for human inherited disease, study of non-synonymous single nucleotide polymorphisms (nsSNPs) are important in delineating the etiology of many such disorders. [12],[13] These SNPs may lead to changes in protein confirmation and may be associated with altered response to drug treatment, susceptibility to disease, and other phenotypic variations. [14] The study of population data for the distribution of NPC1L1 has lead to the identification of six nsSNPs. Among the 6 identified nsSNPs, M510I (rs1468384) shows decrease in the stability of the protein as analyzed in silico by MuPro [15] and StructureSNP [16] softwares. The M510I polymorphism is the result of a nucleotide change G to A at position 2993 of the cDNA sequence in exon 2, and it results in the substitution of isoleucine for methionine at amino acid 510 of the NPC1L1 protein. The SNP has already been studied in Caucasian, Asian, and African American populations by sequencing as given in NCBI database. Till date, no data is available on Indian population. Thus, a reproducible and cost-effective PCR-RFLP based assay was developed to study the distribution of this SNP as well as its frequency distribution comparison with other world populations.


   Materials and Methods Top


High molecular weight genomic DNA was extracted from 3.0 ml of the blood samples collected from 150 normal healthy individuals in the age group 20-50 years with informed consent. The DNA was isolated by methodology as given by Lahiri et al. [17]

Primer designing

The primers for the PCR were designed by using the software GENE RUNNER Version 3.05. The selected primers are listed in the [Table 1].

PCR reaction optimization

The PCR reaction was optimized for 200 ng of DNA. The primer pair selected was 5'TATGGTCGCCCGAAGCACAG3' and 3'GATGGCCACGCACAAACCTG5' were designed using GENERUNNER version 3.05 (Hastings Software Inc. Hastings, NY, USA ( http://www.generunner.com ). A 25 µL PCR mixture was optimized containing 1.5 mM MgC1 2 , 0.4 µM of each primer (Imperial Genetics, USA), 200 µM of each deoxynucleotide triphosphate (Fermentas, USA), 10% Glycerol (Sigma, USA), 1.0 U of Taq polymerase (Intron Technologies, Germany), and buffer concentration of 50 mM KC1 and 10 mM Tris- HCl, pH 8.4. A two-step PCR cycles were optimized, with first step with initial denaturation at 95°C followed by 30 cycles of denaturation at 95°C for 1 min, annealing at 61.5°C for 1 min and extension at 72°C for 1.30 min. This is followed by a final extension (72°C, 5 min) and a 4°C hold. The annealing temperature (Ta) was optimized at 61.5°C. The temperature was calculated using the formula: Ta = 0.3 * Tm primer + 0.7 * Tm product - 14.9, where Tm product = 83°C, and it was Ta = 60.5 °C (±1 °C).The PCR product of size 437 bp was obtained and stored at 4 °C.

RFLP analysis

Five units of BccI (New Englands Biolab) was added to 15 µL of PCR product and incubated overnight at 37°C. Restriction Enzyme BccI with the following recognition site was selected from New England Biolab website http.//www.neb.com/ . All of the digested products were electrophorezed on 10% Polyacrylamide Gel Electrophoresis. The gel was ran at 150V for 3 h. The gel was visualized by Silver Staining. [18]

5'. . . C C A T C (N) 4∇. . . 3'

3'. . . G G T A G (N) 5∇. . . 5'

PCR product purification and sequencing

The PCR product was purified by Na acetate method. [19] To the PCR product added 1/10 th volume of Na-Acetate (3M) followed by twice the volumes of 100% absolute chilled ethanol. The samples were then incubated at -20°C for 1 h. After the incubation period, the sample were centrifuged for 15 min at 10000 RPM at 4°C. Discarded the supernatant and to the pellet added 200 µl of cold 70% Ethanol and re-centrifuged it for 5 min at 4°C. Discarded the supernatant and dissolved the pellet in Tris-EDTA buffer. The purified sample was checked on 1.5% agarose gel as shown in [Figure 1]. The sample was ready for sequencing. The purified sample was submitted to Banglore Genei at Bangalore, India for sequencing.


   Results and Discussion Top


An efficient PCR reaction not only generates product of requisite size but also should utilize the primers completely. Thus, a minimal difference in their melting temperatures (Tm) is favorable [20] and in the case of all primer pairs selected as per [Table 1] the Tm difference is of 1°C. Both primers and target sequence affect this efficiency.

At room temperatures nucleic acids fold into conformations (secondary structures) which have high negative free energy. The stability of these template secondary structures depends largely on their free energy and melting temperatures and is extremely important for designing primers. [21],[22],[23] Keeping these guidelines in mind, the four primer pairs were selected. The primer pair finally selected, had least number of secondary structures, with no hair pin loop, no bulge loops and just 1 internal loop in sense strand at the temperature range during PCR. Further, the 2 dimers in sense strand and 1 in antisense strand were observed to be formed at temperatures far below the experimental temperature range. Moreover the primers so designed were unique i.e., they targeted and amplified only the specific gene in the genomic DNA as given by the Blast [24] [Table 1]. The second primer pair gave minimum and unique hits and was thus selected.

The PCR reaction was set at three different annealing temperatures i.e., 59.5°C, 60.5°C, and 61.5°C. The results are shown in the [Figure 2]. The annealing temperature of 61.5°C proved to be the most stringent, giving optimum results at which no spurious amplification were observed in the PCR products as compared to other temperatures [Figure 2].

The optimization of amount of Taq polymerase and number of PCR cycles was then carried out. The amount of Taq polymerase was tested in the range 0.25 to 2 U per reaction. As little as 0.5 U enzymes could be used without a decrease in the yield of PCR product (data not shown). PCR was performed for 25, 30, and 35, cycles, including the initial cycle. The PCR products could be detected after 25 cycles, maximal PCR product was obtained with 30 cycles of PCR amplification without the production of nonspecific amplification and complete utilization of primers (data not shown). The product was purified and sequenced to confirm the region amplified. The [Figure 3] depicts the sequence of the PCR product as obtained from Bangalore Genei and viewed in CHROMAS.

The amplified product was subjected to digestion by Bcc1 restriction enzyme. After digestion of the 437 bp fragment obtained by PCR, the three possible genotypes were distinguishable: homozygous GG (437 bp), heterozygous GA (437, 278 and 159 bp), and homozygous AA (278 and 159 bp). The [Table 2] and the gel picture [Figure 4] below depicts the band pattern for different genotypes.

The genotype frequency distribution for the M510I polymorphism is shown in [Table 3]. The difference in allele frequency distribution between different population groups was observed. The "G" allele present in Indian Population showed the least frequency of 0.46 (95% CI) and Caucasian Population samples the maximum at 1.000. For "A" allele it is 0.54 (95% CI) in Indian Population [Table 4]. The data was then analyzed for χ2 value to study difference in allele distribution amongst the Indian population and other populations of the world studied so far [Table 5]. Statistically, highly significant differences were observed on comparison with these populations. Even the population labeled as Asian on closer scrutiny was found to be a mixed group constituted of populations of mongoloid origin like the Chinese, Malaysians, etc. This group also showed the allele distribution to be highly significantly different from the North Western Indian Population under study.

The above analysis makes it very clear that the PCR-RFLP methodology optimized in current study is robust enough allowing screening of populations for NPC1L1 SNP rs1468384. The earlier studies using sequencing are not only expensive but also not amenable to high throughput population screening.


   Conclusion Top


The PCR-RFLP technique described here is a proficient NPC1L1 genotyping assay starting with 50 ng genomic DNA extracted from 0.3 mL of blood that makes it cost effective as well as time and labor saving. The PCR product enhancement and specificity were improved by using 10% glycerol. The use of less Taq polymerase, single-step PCR cycling, and polyacrylamide gel electrophoresis not only improved efficiency but also lowered the cost per test. The protocol is thus useful for clinical diagnostic laboratory as well as a research laboratory performing population screening. The importance of study of this SNP lies in the fact that it is predicted to lead to localized structural instability that may have functional implications in disorders involving cholesterol influx, drug binding and susceptibility to complex disorders.


   Acknowledgment Top


Ms. Divya Khanna is thankful to Council of Scientific and Industrial Research, New Delhi for award no. CSIR SRF F.No. 9/140(138)/2004 EMR-1 of Senior Research Fellowship.

 
   References Top

1.Lammert F, Wang DQ. New Insights into the genetic regulation of intestinal cholesterol absorption. Gastroenterology 2005;129:718-34.  Back to cited text no. 1  [PUBMED]  [FULLTEXT]
2.Yu L, Bharadwaj S, Brown JM, Ma Y, Du W, Davis MA, et al. Cholesterol-regulated translocation of NPC1L1 to the cell surface facilitates free cholesterol uptake. J Biol Chem 2006;281:6616-24.  Back to cited text no. 2  [PUBMED]  [FULLTEXT]
3.Altmann SW, Davis HR Jr, Zhu LJ, Yao X, Hoos LM, Tetzloff G, et al. Niemann-Pick C1 Like 1 protein is critical for intestinal cholesterol absorption. Science 2004;303:201-4.  Back to cited text no. 3    
4.Davies JP, Levy B, Ioannou YA. Evidence for a Niemann-Pick C (NPC) gene family: Identification and characterization of NPC1L1. Genomics 2000;65:137-45.  Back to cited text no. 4  [PUBMED]  [FULLTEXT]
5.Davies JP, Scott C, Oishi K, Liapis A, Ioannou YA. Inactivation of NPC1L1 causes multiple lipid transport defects and protects against diet-induced hypercholesterolemia. J Biol Chem 2005;280:12710-20.  Back to cited text no. 5  [PUBMED]  [FULLTEXT]
6.Van Heek M, Farley C, Compton DS, Hoos L, Alton KB, Sybertz EJ, et al. Comparison of the activity and disposition of the novel cholesterol absorption inhibitor, SCH58235, and its glucuronide, SCH60663. Br J Pharmacol 2000;129:1748-54.  Back to cited text no. 6  [PUBMED]  [FULLTEXT]
7.Field FK, Watt K, Mathur SN. Ezetimibe interfere with cholesterol trafficking from the plasma membrane to the endoplasmic reticulum in CaCo-2 cells. J Lipid Res 2007;48:1735-45.  Back to cited text no. 7    
8.Garcia-Calvo M, Lisnock J, Bull HG, Hawes BE, Burnett DA, Braun MP, et al. The target of ezetimibe is Niemann-Pick C1-Like 1 (NPC1L1). Proc Natl Acad Sci USA 2005;102:8132-7.  Back to cited text no. 8  [PUBMED]  [FULLTEXT]
9.Temel RE, Tang W, Ma Y, Rudel LL, Willingham CM, Ioannou AY, et al. 1 Hepatic Niemann-Pick C1-like 1 regulates biliary cholesterol concentration and is a target of ezetimibe. J Clin Investig 2007;117:1968-78.  Back to cited text no. 9    
10.Sane AT, Sinnett D, Delvin M, Bendayan V, Marcil D, Menard JF, et al. Localization and role of NPC1L1 in cholesterol absorption in human intestine. J Lipid Res 2006;47:2112-20.  Back to cited text no. 10    
11.Turley SD. Role of Niemann-pick C1-like 1 (NPC1L1) in intestinal sterol absorption. J Clin Lipid 2008;2:S20-8.  Back to cited text no. 11    
12.Krawczak M, Ball EV, Fenton I, Stenson PD, Abeysinghe S, Thomas N, et al. Human gene mutation database: A biomedical information and research resource. Hum Mutat 2000;15:45-51.  Back to cited text no. 12  [PUBMED]  [FULLTEXT]
13.Schifreen RS, Storts DR, Buller AM. The challenge of using SNPs in the understanding and treatment of disease. BioTechniques 2002;32:S14-21.  Back to cited text no. 13    
14.Dolores C, Jose MO. Single nucleotide polymorphisms that influence lipid metabolism: interaction with dietary factors. Annu Rev Nutr 2005;25:341-90.  Back to cited text no. 14    
15.Cheng J, Randall A, Baldi P. Prediction of protein stability changes for single-site mutations using support vector machines. Proteins 2006;62:1125-32.  Back to cited text no. 15  [PUBMED]  [FULLTEXT]
16.Uzun A, Leslin C, Abyzov A, Ilyin V. Structure SNP (StSNP) database: A tool for modeling nsSNPs locations on proteins and presenting their metabolic pathways. Nucleic Acid Res 2007;35:W384-92.  Back to cited text no. 16    
17.Lahiri DK, Nurnberger JI. A rapid non-enzymatic method for the preparation of HMW DNA from blood for RFLP studies. Nucleic Acids Res 1991;19:5444.  Back to cited text no. 17    
18.Allen RC, Graves GM, Budowle B. Polymerase chain reaction amplification products separated on rehydratable polyacrylamide gels and stained with silver. Biotechniques 1989;7:736-44.  Back to cited text no. 18    
19.Moss P, Thein SL. Sequencing of PCR products. Met Mole Med 1998;16:145-8.  Back to cited text no. 19    
20.Vieux EF, Kwok Pui-Y, Miller RD. Primer design for PCR and sequencing in high-throughput analysis of SNPs. BioTechniques 2002;32:S28-32.  Back to cited text no. 20    
21.Abd-Elsalam KA. Bioinformatic tools and guideline for PCR primer design. Afr J Biotechnol 2003;2:91-5.  Back to cited text no. 21    
22.Dieffenbach CW, Lowe TM, Dveksler GS. General concepts for PCR primer design. In: Dieffenbach CW, Dveksler GS, editors. PCR primer, a laboratory manual. New York: Cold Spring Harbor Laboratory Press; 1995. p. 133-55.  Back to cited text no. 22    
23.He Q, Marjamaki M, Soini H, Mertsola J, Viljanen MK. Primers are decisive for sensitivity of PCR. Biotechniques 1994;17:82-7.  Back to cited text no. 23    
24.Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990;215:403-10.  Back to cited text no. 24  [PUBMED]  [FULLTEXT]


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4], [Table 5]



 

Top
Print this article  Email this article
          Previous article         Next article

    

 
   Search
 
   Next article
   Previous article 
   Table of Contents
  
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Article in PDF (265 KB)
    Citation Manager
    Access Statistics
    Reader Comments
    Email Alert *
    Add to My List *
* Registration required (free)  


    Abstract
    Introduction
    Materials and Me...
    Results and Disc...
    Conclusion
    Acknowledgment
    References
    Article Figures
    Article Tables

 Article Access Statistics
    Viewed1874    
    Printed94    
    Emailed0    
    PDF Downloaded213    
    Comments [Add]    

Recommend this journal